Review





Similar Products

99
Thermo Fisher gene exp il10 mm01288386 m1
Gene Exp Il10 Mm01288386 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp il10 mm01288386 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp il10 mm01288386 m1 - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

94
MedChemExpress b429257 mouse il10 medchemexpress
B429257 Mouse Il10 Medchemexpress, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/b429257 mouse il10 medchemexpress/product/MedChemExpress
Average 94 stars, based on 1 article reviews
b429257 mouse il10 medchemexpress - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp il10 rn00563409 m1
Gene Exp Il10 Rn00563409 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp il10 rn00563409 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp il10 rn00563409 m1 - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp il10 hs00961622 m1
Effect of the S-MenSC secretomes on monocyte differentiation. Monocytes were differentiated into MDMs for 7 days in the presence of basal (S-bMenSC) or IFNγ/TNFα-primed (S-pMenSC) secretomes. (A) Flow cytometry analysis of M1-associated markers (CD80, CD86) and M2-associated markers (CD163, CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B, IL6, TNF ) and anti-inflammatory cytokines ( <t>IL10,</t> TGFB ). Data are presented as mean ± SEM. Statistical significance was determined using the Friedman test with Dunn’s multiple comparisons (n = 3): *, p < 0.05; **, p < 0.005. NT, non-treated monocytes; S-bM, monocytes treated with basal MenSC secretome; S-pM, monocytes treated with primed MenSC secretome.
Gene Exp Il10 Hs00961622 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp il10 hs00961622 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp il10 hs00961622 m1 - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp il10 mm00439616 m1
Effect of the S-MenSC secretomes on monocyte differentiation. Monocytes were differentiated into MDMs for 7 days in the presence of basal (S-bMenSC) or IFNγ/TNFα-primed (S-pMenSC) secretomes. (A) Flow cytometry analysis of M1-associated markers (CD80, CD86) and M2-associated markers (CD163, CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B, IL6, TNF ) and anti-inflammatory cytokines ( <t>IL10,</t> TGFB ). Data are presented as mean ± SEM. Statistical significance was determined using the Friedman test with Dunn’s multiple comparisons (n = 3): *, p < 0.05; **, p < 0.005. NT, non-treated monocytes; S-bM, monocytes treated with basal MenSC secretome; S-pM, monocytes treated with primed MenSC secretome.
Gene Exp Il10 Mm00439616 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp il10 mm00439616 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp il10 mm00439616 m1 - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

89
Thermo Fisher snp il10 c 1747363 10
Allele frequency comparison between the cohort and 1000 Genomes AMR/CLM populations. Bar plot displaying allele frequencies for MMP1 rs1799750 (2G), <t>IL10</t> rs1800872 (T), and IL17A rs7747909 (A). Values from the study cohort are shown along with reference frequencies from the Admixed American (AMR) and Colombian (CLM) populations of the 1000 Genomes Project. This comparison contextualizes the plausibility of allele distribution following genotyping QC.
Snp Il10 C 1747363 10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/snp il10 c 1747363 10/product/Thermo Fisher
Average 89 stars, based on 1 article reviews
snp il10 c 1747363 10 - by Bioz Stars, 2026-03
89/100 stars
  Buy from Supplier

Image Search Results


Effect of the S-MenSC secretomes on monocyte differentiation. Monocytes were differentiated into MDMs for 7 days in the presence of basal (S-bMenSC) or IFNγ/TNFα-primed (S-pMenSC) secretomes. (A) Flow cytometry analysis of M1-associated markers (CD80, CD86) and M2-associated markers (CD163, CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B, IL6, TNF ) and anti-inflammatory cytokines ( IL10, TGFB ). Data are presented as mean ± SEM. Statistical significance was determined using the Friedman test with Dunn’s multiple comparisons (n = 3): *, p < 0.05; **, p < 0.005. NT, non-treated monocytes; S-bM, monocytes treated with basal MenSC secretome; S-pM, monocytes treated with primed MenSC secretome.

Journal: Frontiers in Cell and Developmental Biology

Article Title: Menstrual blood-derived mesenchymal stromal cell secretome modulates macrophage polarization in a preconditioning-dependent manner

doi: 10.3389/fcell.2025.1691010

Figure Lengend Snippet: Effect of the S-MenSC secretomes on monocyte differentiation. Monocytes were differentiated into MDMs for 7 days in the presence of basal (S-bMenSC) or IFNγ/TNFα-primed (S-pMenSC) secretomes. (A) Flow cytometry analysis of M1-associated markers (CD80, CD86) and M2-associated markers (CD163, CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B, IL6, TNF ) and anti-inflammatory cytokines ( IL10, TGFB ). Data are presented as mean ± SEM. Statistical significance was determined using the Friedman test with Dunn’s multiple comparisons (n = 3): *, p < 0.05; **, p < 0.005. NT, non-treated monocytes; S-bM, monocytes treated with basal MenSC secretome; S-pM, monocytes treated with primed MenSC secretome.

Article Snippet: The following TaqMan probes were utilized for gene expression analysis: TNF (hs00174128_m1), IL6 (hs00174134_m1), IL1B (hs01555410_m1), TGFB (hs00998133_m1), IL10 (hs00961622_m1), and TBP (hs00427620_m1), the latter as reference gene.

Techniques: Flow Cytometry, Fluorescence, Quantitative RT-PCR

Effect of MenSC-derived secretomes on M1-like MDM polarization. Expression of M1-and M2-associated markers was analyzed in MDMs committed to an M1-like phenotype following treatment with S-MenSCs during the polarization phase. (A) Flow cytometry analysis of M1-associated markers (CD80 and CD86) and M2-associated markers (CD163 and CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B , IL6 , and TNF ) and anti-inflammatory cytokines ( IL10, TGFB ). Data are presented as mean ± SEM. For n = 6 donors, normality was assessed by Shapiro–Wilk test; normally distributed data were analyzed by repeated-measures one-way ANOVA with Tukey’s post hoc test, and non-normal data by Friedman test with Dunn’s multiple comparisons. *, p < 0.05 and **, p < 0.005. NT, non-treated MDMs; S-bM, MDMs treated with secretome from basal MenSCs (S-bMenSC); S-pM, MDMs treated with secretome from IFNγ/TNFα-primed MenSCs (S-pMenSC).

Journal: Frontiers in Cell and Developmental Biology

Article Title: Menstrual blood-derived mesenchymal stromal cell secretome modulates macrophage polarization in a preconditioning-dependent manner

doi: 10.3389/fcell.2025.1691010

Figure Lengend Snippet: Effect of MenSC-derived secretomes on M1-like MDM polarization. Expression of M1-and M2-associated markers was analyzed in MDMs committed to an M1-like phenotype following treatment with S-MenSCs during the polarization phase. (A) Flow cytometry analysis of M1-associated markers (CD80 and CD86) and M2-associated markers (CD163 and CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B , IL6 , and TNF ) and anti-inflammatory cytokines ( IL10, TGFB ). Data are presented as mean ± SEM. For n = 6 donors, normality was assessed by Shapiro–Wilk test; normally distributed data were analyzed by repeated-measures one-way ANOVA with Tukey’s post hoc test, and non-normal data by Friedman test with Dunn’s multiple comparisons. *, p < 0.05 and **, p < 0.005. NT, non-treated MDMs; S-bM, MDMs treated with secretome from basal MenSCs (S-bMenSC); S-pM, MDMs treated with secretome from IFNγ/TNFα-primed MenSCs (S-pMenSC).

Article Snippet: The following TaqMan probes were utilized for gene expression analysis: TNF (hs00174128_m1), IL6 (hs00174134_m1), IL1B (hs01555410_m1), TGFB (hs00998133_m1), IL10 (hs00961622_m1), and TBP (hs00427620_m1), the latter as reference gene.

Techniques: Derivative Assay, Expressing, Flow Cytometry, Fluorescence, Quantitative RT-PCR

Effect of MenSC-derived secretomes on M2-like MDM polarization. Expression of M1-and M2-associated markers was analyzed in MDMs committed to an M2-like phenotype following treatment with S-MenSCs during the polarization phase. (A) Flow cytometry analysis of M1-associated markers (CD80 and CD86) and M2-associated markers (CD163 and CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B , IL6 , and TNF ) and anti-inflammatory cytokines ( IL10, TGFB ). Data are presented as mean ± SEM. For n = 6 donors, normality was assessed by Shapiro–Wilk test; normally distributed data were analyzed by repeated-measures one-way ANOVA with Tukey’s post hoc test, and non-normal data by Friedman test with Dunn’s multiple comparisons. *, p < 0.05 and **, p < 0.005. NT, non-treated MDMs; S-bM, MDMs treated with secretome from basal MenSCs (S-bMenSC); S-pM, MDMs treated with secretome from IFNγ/TNFα-primed MenSCs (S-pMenSC).

Journal: Frontiers in Cell and Developmental Biology

Article Title: Menstrual blood-derived mesenchymal stromal cell secretome modulates macrophage polarization in a preconditioning-dependent manner

doi: 10.3389/fcell.2025.1691010

Figure Lengend Snippet: Effect of MenSC-derived secretomes on M2-like MDM polarization. Expression of M1-and M2-associated markers was analyzed in MDMs committed to an M2-like phenotype following treatment with S-MenSCs during the polarization phase. (A) Flow cytometry analysis of M1-associated markers (CD80 and CD86) and M2-associated markers (CD163 and CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B , IL6 , and TNF ) and anti-inflammatory cytokines ( IL10, TGFB ). Data are presented as mean ± SEM. For n = 6 donors, normality was assessed by Shapiro–Wilk test; normally distributed data were analyzed by repeated-measures one-way ANOVA with Tukey’s post hoc test, and non-normal data by Friedman test with Dunn’s multiple comparisons. *, p < 0.05 and **, p < 0.005. NT, non-treated MDMs; S-bM, MDMs treated with secretome from basal MenSCs (S-bMenSC); S-pM, MDMs treated with secretome from IFNγ/TNFα-primed MenSCs (S-pMenSC).

Article Snippet: The following TaqMan probes were utilized for gene expression analysis: TNF (hs00174128_m1), IL6 (hs00174134_m1), IL1B (hs01555410_m1), TGFB (hs00998133_m1), IL10 (hs00961622_m1), and TBP (hs00427620_m1), the latter as reference gene.

Techniques: Derivative Assay, Expressing, Flow Cytometry, Fluorescence, Quantitative RT-PCR

Effect of S-MenSCs in M1-like MDMs. In vitro differentiated and polarized M1-like MDMs were treated for 48 h with S-MenSC (100 μg/mL). (A) Flow cytometry analysis of M1-associated markers (CD80 and CD86) and M2-associated markers (CD163 and CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B , IL6 , and TNF ) and anti-inflammatory cytokines ( IL10, TGFB ). Data represent mean ± SEM. Statistical significance was determined using the Friedman test with Dunn’s multiple comparisons (n = 3): *, p < 0.05; **, p < 0.005. (n = 3): *, p < 0.05 and **, p < 0.005. NT, non-treated MDMs; S-bM, MDMs treated with secretome released by menstrual blood-derived stromal cells in basal conditions (S-bMenSC); S-pM, MDMs treated with secretome released by menstrual blood-derived stromal cells pre-conditioned with IFNγ and TNFα (S-pMenSC).

Journal: Frontiers in Cell and Developmental Biology

Article Title: Menstrual blood-derived mesenchymal stromal cell secretome modulates macrophage polarization in a preconditioning-dependent manner

doi: 10.3389/fcell.2025.1691010

Figure Lengend Snippet: Effect of S-MenSCs in M1-like MDMs. In vitro differentiated and polarized M1-like MDMs were treated for 48 h with S-MenSC (100 μg/mL). (A) Flow cytometry analysis of M1-associated markers (CD80 and CD86) and M2-associated markers (CD163 and CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B , IL6 , and TNF ) and anti-inflammatory cytokines ( IL10, TGFB ). Data represent mean ± SEM. Statistical significance was determined using the Friedman test with Dunn’s multiple comparisons (n = 3): *, p < 0.05; **, p < 0.005. (n = 3): *, p < 0.05 and **, p < 0.005. NT, non-treated MDMs; S-bM, MDMs treated with secretome released by menstrual blood-derived stromal cells in basal conditions (S-bMenSC); S-pM, MDMs treated with secretome released by menstrual blood-derived stromal cells pre-conditioned with IFNγ and TNFα (S-pMenSC).

Article Snippet: The following TaqMan probes were utilized for gene expression analysis: TNF (hs00174128_m1), IL6 (hs00174134_m1), IL1B (hs01555410_m1), TGFB (hs00998133_m1), IL10 (hs00961622_m1), and TBP (hs00427620_m1), the latter as reference gene.

Techniques: In Vitro, Flow Cytometry, Fluorescence, Quantitative RT-PCR, Derivative Assay

Effect of S-MenSCs in M2-like MDMs. In vitro differentiated and polarized M2-like MDMs were treated for 48 h with S-MenSC (100 μg/mL). (A) Flow cytometry analysis of M1-associated markers (CD80 and CD86) and M2-associated markers (CD163 and CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B , IL6 , and TNF ) and anti-inflammatory cytokines ( IL10, TGFB ). Data represent mean ± SEM. Statistical significance was determined using the Friedman test with Dunn’s multiple comparisons (n = 3): *, p < 0.05; **, p < 0.005. (n = 3): *, p < 0.05 and **, p < 0.005. NT, non-treated MDMs; S-bM, MDMs treated with secretome released by menstrual blood-derived stromal cells in basal conditions (S-bMenSC); S-pM, MDMs treated with secretome released by menstrual blood-derived stromal cells pre-conditioned with IFNγ and TNFα (S-pMenSC).

Journal: Frontiers in Cell and Developmental Biology

Article Title: Menstrual blood-derived mesenchymal stromal cell secretome modulates macrophage polarization in a preconditioning-dependent manner

doi: 10.3389/fcell.2025.1691010

Figure Lengend Snippet: Effect of S-MenSCs in M2-like MDMs. In vitro differentiated and polarized M2-like MDMs were treated for 48 h with S-MenSC (100 μg/mL). (A) Flow cytometry analysis of M1-associated markers (CD80 and CD86) and M2-associated markers (CD163 and CD206), represented as both the frequency of positive cells (% of cells) and the geometric mean fluorescence intensity (GeoMean). (B) RT-qPCR analysis of pro-inflammatory cytokines ( IL1B , IL6 , and TNF ) and anti-inflammatory cytokines ( IL10, TGFB ). Data represent mean ± SEM. Statistical significance was determined using the Friedman test with Dunn’s multiple comparisons (n = 3): *, p < 0.05; **, p < 0.005. (n = 3): *, p < 0.05 and **, p < 0.005. NT, non-treated MDMs; S-bM, MDMs treated with secretome released by menstrual blood-derived stromal cells in basal conditions (S-bMenSC); S-pM, MDMs treated with secretome released by menstrual blood-derived stromal cells pre-conditioned with IFNγ and TNFα (S-pMenSC).

Article Snippet: The following TaqMan probes were utilized for gene expression analysis: TNF (hs00174128_m1), IL6 (hs00174134_m1), IL1B (hs01555410_m1), TGFB (hs00998133_m1), IL10 (hs00961622_m1), and TBP (hs00427620_m1), the latter as reference gene.

Techniques: In Vitro, Flow Cytometry, Fluorescence, Quantitative RT-PCR, Derivative Assay

Allele frequency comparison between the cohort and 1000 Genomes AMR/CLM populations. Bar plot displaying allele frequencies for MMP1 rs1799750 (2G), IL10 rs1800872 (T), and IL17A rs7747909 (A). Values from the study cohort are shown along with reference frequencies from the Admixed American (AMR) and Colombian (CLM) populations of the 1000 Genomes Project. This comparison contextualizes the plausibility of allele distribution following genotyping QC.

Journal: Current Issues in Molecular Biology

Article Title: Host Immunogenetic Profile Modulates Susceptibility to Apical Periodontitis in a Colombian Population

doi: 10.3390/cimb48010107

Figure Lengend Snippet: Allele frequency comparison between the cohort and 1000 Genomes AMR/CLM populations. Bar plot displaying allele frequencies for MMP1 rs1799750 (2G), IL10 rs1800872 (T), and IL17A rs7747909 (A). Values from the study cohort are shown along with reference frequencies from the Admixed American (AMR) and Colombian (CLM) populations of the 1000 Genomes Project. This comparison contextualizes the plausibility of allele distribution following genotyping QC.

Article Snippet: IL10 , rs1800872 (−592 C>A) , C___1747363_10 , CTTTCCAGAGACTGGCTTCCTACAG [T/G]ACAGGCGGGGTCACAGGATGTGTTC.

Techniques: Comparison